Services - DNA Sequencing Electropherogram
Figure 4
Electropherogram with unincorporated nucleotide peaks.

The electropherogram below has very large peaks at the beginning of the sequence (scan lines 0 to 320), and these peaks are unincorporated nucleotides that can mask the true sequence of the template. The true sequence for bases 1 to 25 is “TAGATTCGGGTACCTTAGTGA”. The intensity of the unincorporated peaks varies depending upon the efficiency of the sequencing reaction and the efficiency of the sequencing reaction cleanup procedure (gel filtration or solid phase extraction) after the reaction. The cleanup procedure is performed to remove salts and unincorporated nucleotides prior to electrophoresis. The best solution to this limitation is to edit the sequence manually by looking at the peaks underneath the unincorporated nucleotide peaks.



 Electropherogram with unincorporated nucleotide peaks